Research Article Open Access

Molecular Identification of Domestic and Wild Boars Using Cytochrome-b Specific Primers for Halal Authentication

Rifqi1, Edi Suryanto1, Ari Surya Sukarno1, Rusman1, Nanung Agus Fitriyanto1, Abdul Rohman2 and Yuny Erwanto1,2
  • 1 Department of Animal Products, Faculty of Animal Science, Universitas Gadjah Mada, Yogyakarta, Indonesia
  • 2 Institute for Halal Industry and System, Universitas Gadjah Mada, Yogyakarta, Indonesia

Abstract

The subject of adulterating wild boar and pig meat products with other animal meat is delicate, particularly in the Muslim nation of Indonesia. In recent years, there has been a lot of concern over halal meat products that contain wild boar and pig meat due to Economically Motivated Adulteration (EMA). However, there are limited studies of PCR-DNA-based to discriminate between domestic pigs and wild boars. This study aims to design species-specific primers to identify wild boar in the cytochrome-B gen region. DNA from seven animals (wild boar, pig, cow, sheep, goat, chicken, and fish) was extracted. Both conventional and real-time PCR were used for qualitative and quantitative identification. The cytochrome-B gene of wild boar and pig was sequenced, and this region was then used to design primers using Prime Quest. Designed primers were characterized by four criteria: specificity, sensitivity, limit detection, and repetition tests. The set of primers designed for amplification consisted of Cyt-B Forward1715'CGAGACGTAAATTACGGATGAC'3 and Reverse-4885'GGTAATGATGAAGGGCAGGATG'3. The results of this study showed the primer amplificated wild boar DNA, specifically with an annealing temperature of 53°C, performed in a 25 cycle RT-PCR system. Good recommendations were shown by the sensitivity test (R2 = 0.9817, slope = -3,4742, y-intercept = 30,625; and efficiency = 94%). In conclusion, the adulteration of wild boar meat in food products can be detected using a specially designed primer. The proposed primer can be used to identify wild boars in products sold on the commercial market, according to the results of qualitative and quantitative tests.

American Journal of Animal and Veterinary Sciences
Volume 20 No. 3, 2025, 245-254

DOI: https://doi.org/10.3844/ajavsp.2025.245.254

Submitted On: 6 January 2025 Published On: 14 November 2025

How to Cite: Rifqi, Suryanto, E., Sukarno, A. S., Rusman, ., Fitriyanto, N. A., Rohman, A. & Erwanto, Y. (2025). Molecular Identification of Domestic and Wild Boars Using Cytochrome-b Specific Primers for Halal Authentication. American Journal of Animal and Veterinary Sciences, 20(3), 245-254. https://doi.org/10.3844/ajavsp.2025.245.254

  • 1,340 Views
  • 763 Downloads
  • 0 Citations

Download

Keywords

  • Adulteration
  • DNA
  • Identification
  • Primer Design
  • Wild Boar